View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_25 (Length: 264)
Name: NF1466_low_25
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 26999798 - 26999589
Alignment:
| Q |
20 |
tagaacacataaaattattattgatgtcattatatttgtaatattaattaaaacaaatagatgtcattgaaaattctagtttcgcagaataagcatcaac |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26999798 |
tagaacacataaaattattattga-gtctctatatatgtaatattaattaaaacaaatagatgtcattgaaaattctagtttcgcagaataagcatcaac |
26999700 |
T |
|
| Q |
120 |
tatcggtagctacactcaataaatatatacacactaacattatgttggtccttgtggaattttactcggatctcttaaggtctcaggtccacgcacggtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26999699 |
tatcggtagctacactcaataaatatatacacactaacattatgttggtctttgtggaattttactcggatctcttaaggtctcagatccacgcacggtg |
26999600 |
T |
|
| Q |
220 |
gatgaaaaata |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
26999599 |
gatgaaaaata |
26999589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 222 - 252
Target Start/End: Complemental strand, 26999559 - 26999529
Alignment:
| Q |
222 |
tgaaaaataggttctgaagcggagaataatc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26999559 |
tgaaaaataggttctgaagcggagaataatc |
26999529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University