View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_32 (Length: 249)
Name: NF1466_low_32
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 80 - 240
Target Start/End: Complemental strand, 33264551 - 33264391
Alignment:
| Q |
80 |
gatgctacctttgcgagcgtaggtggttcatgtgcatgttcaactcgttttggtggacgaccgcgcccacaatattttggtgcttcctcctctttctctc |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||| |
|
|
| T |
33264551 |
gatgctacctttgcgagagtaggtggttcatgtgcatgttcaactcgttttggtggacgaccacgcccacaatattttggggcctcctcctctttctctc |
33264452 |
T |
 |
| Q |
180 |
cctggagcaacacaaatttagccatatggtcttaattattcaatcctcttaggagaataat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
33264451 |
cctggagcaacacaaatttagccatatggtcttaattattcaatcctcttgggagattaat |
33264391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 34
Target Start/End: Complemental strand, 33264626 - 33264597
Alignment:
| Q |
5 |
atgacatttgtatatgatgagatccccaat |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33264626 |
atgacatttgtatatgatgagatccccaat |
33264597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University