View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_41 (Length: 215)
Name: NF1466_low_41
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 41113960 - 41114159
Alignment:
| Q |
1 |
tcataacgtctccaacttgagaagtttgacaccatgtgtgaggcagtctgcattagaaaaaatccaatccaacataaggaccatctaactgacaatacac |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41113960 |
tcataacgtctccatcttgagaagtttgacaccatgtgtgaggcagtctgcattagaaaaaatccaatccaacataaggaccatctaactgacaatacac |
41114059 |
T |
|
| Q |
101 |
aatgtcacgaactaatttttcccaaaatattttataaacgttttctaccttcattttttattgtaaaactgaaccgatggtttcactcaatttcatttct |
200 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41114060 |
actgtcacgaactaatttttaccaaaatattttataaacgttttctaccttcattttttattgtaaaactgatccgatggtttcactcaatttcatttct |
41114159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University