View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_42 (Length: 212)
Name: NF1466_low_42
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 44575326 - 44575149
Alignment:
| Q |
17 |
acatcataggcccttcgacagacatttttctcatcatattgttgctgacaaatgttcattccccccaaaaaagtaaatctacagtacttatcttacaact |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575326 |
acatcataggcccttcgacgaacatttttctcatcatattgttgctgacaaatgttcattccccccaaaaaagtaaatctacagtacttatcttacaact |
44575227 |
T |
 |
| Q |
117 |
taaatatctgaatagcaaataattttgaaactgtttgtaaaggaaaaacaaccttattaggggacaaaccactattca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575226 |
taaatatctgaatagcaaataattttgaaactgtttgtaaaggaaaaacaaccttattaggggacaaaccactattca |
44575149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 29872629 - 29872543
Alignment:
| Q |
18 |
catcataggcccttcgacagacatttttctcatcatattgttgctgacaaatgttcattccccccaaaaaagtaaatctacagtactt |
105 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||||||||||| || ||||| | ||||||||| |||||| ||||| |
|
|
| T |
29872629 |
catcatagacccttcgacgaatgtttttctcatcatattgttgctgacaaatgtccaatccccac-aaaaagtaagtctacaatactt |
29872543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University