View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1466_low_6 (Length: 440)
Name: NF1466_low_6
Description: NF1466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1466_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 406
Target Start/End: Original strand, 31829160 - 31829586
Alignment:
| Q |
1 |
aggaatttggtacaccagttttgtttttagattttggagggcttgtttgcaattggtgatctaagtgtgcattgttagtttagcttttgg---------- |
90 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31829160 |
aggaatttggtacaccagttttgtctttagattttggagtgcttgtttgcaattggtgatctaagtgtgcgttgttagtttatcttttgggatttatgca |
31829259 |
T |
 |
| Q |
91 |
-----------gtctagttgcaaaactaagatatctatttctgggccagaaaattgtgtactgtgagatgagcagcaatgcacttcggaggctacaattg |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
31829260 |
agttatcttgggtctagttgcaaaactgagatatctatttctgggccagaaaattgtgtactgtgagatgagcagcaatgcacctctgaggctacaattg |
31829359 |
T |
 |
| Q |
180 |
aatggactgtttccatacaagccaaacgattttagtttactgaataatttgaagttccaaccagctgcagagattaacccaaaggagaaccgtgtagagt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31829360 |
aatggactgtttccatacaagccaaacgattttagtttattgaataatttgaagttccaaccagctgcagagattaacccaaaggagaaccgtgtagagt |
31829459 |
T |
 |
| Q |
280 |
atcatgtgatttgaagctttgaagcccctagaccaggttatgatctaacaacctagacaggcggcttccacgtcagggccttgtgctgttcgtatgtttg |
379 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31829460 |
atcatgtgatttgaagcattgaagcccctagaccaggttatgatctaacaacctagacaggcagcttccacgtcagggccttgtgctgttcgtatgtttg |
31829559 |
T |
 |
| Q |
380 |
acgagcatttgtatgctcaggcaagtt |
406 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31829560 |
acgagcatttgtatgctcaggcaagtt |
31829586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University