View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14670_high_6 (Length: 233)
Name: NF14670_high_6
Description: NF14670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14670_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 91 - 215
Target Start/End: Complemental strand, 1409727 - 1409603
Alignment:
| Q |
91 |
agacccacgagaaattataccccaatgaagcttattaatcccagcagctaagaaatgagtttttaatgggtttttgattttgaattttctttaggtcaca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1409727 |
agacccacgagaaattataccccaatgaagcttattaatcccagcagctaagaaatgagtttttaatgggtttttgattttgaattttctttgggtcaca |
1409628 |
T |
 |
| Q |
191 |
ggtttcgatttgcagaagaagagag |
215 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1409627 |
ggtttcgatttgcagaagaagagag |
1409603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University