View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14672_low_11 (Length: 229)
Name: NF14672_low_11
Description: NF14672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14672_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 15 - 130
Target Start/End: Original strand, 45345904 - 45346019
Alignment:
| Q |
15 |
acagaaccaacagttatatcctttctaaatcctccttcagtgaagactttgcggtggatactagcaccaactgaacctgtaggatcctgaaactcaaact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345904 |
acagaaccaacagttatatcctttctaaatcctccttcagtgaagactttgcggtggatactagcaccaactgaacctgtaggatcctgaaactcaaact |
45346003 |
T |
 |
| Q |
115 |
cttgaatcagaagcat |
130 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45346004 |
cttgaatcagaagcat |
45346019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 45346059 - 45346108
Alignment:
| Q |
165 |
agaacaggacctttagggtaaccgtcatgtctccaaaaccgttaggagtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346059 |
agaacaggacctttagggtaaccgtcatgtctccaaaaccgttaggagtg |
45346108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University