View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14672_low_12 (Length: 222)
Name: NF14672_low_12
Description: NF14672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14672_low_12 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 785180 - 785401
Alignment:
| Q |
1 |
aaaagtaattctccaaaatgtttgaataatatcatttcaaagtcatctaatagacagcaactcaatctagacatcaacatcaaatttatttctccacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785180 |
aaaagtaattctccaaaatgtttgaataatatcatttcaaagtcatctaatagacagcaactcaatctagacatcaacatcaaatttatttctccacaac |
785279 |
T |
|
| Q |
101 |
gcaaacagttgcagttaaaactatgtgtatgtttagcatcatgattatttacctaaactaagttgaaccagtgtaattttgtaaaagttacactatgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785280 |
gcaaacagttgcagttaaaactatgtgtatgtttagcatcatgattatttacctaaactaagttgaaccagtgtaattttgtaaaagttacactatgtaa |
785379 |
T |
|
| Q |
201 |
ccacctctgttgcactgacact |
222 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
785380 |
ccacctctgttgcacggacact |
785401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University