View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14672_low_9 (Length: 243)
Name: NF14672_low_9
Description: NF14672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14672_low_9 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 3 - 243
Target Start/End: Original strand, 37565406 - 37565646
Alignment:
| Q |
3 |
atgttgctggagcattatcactgaattctatgttccaactagcccaaatactatacttgagcttggttatgtagacatcaacaactagttttgatttgga |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565406 |
atgttgctggagcattatcactaaattctatgttccaactagcccaaatactatacttgagcttggttatgtagacatcaacaactagttttgatttgga |
37565505 |
T |
|
| Q |
103 |
gcattttatgtataactcttgtaccgatgttttgatttagaatgctagtgcagatgcagtgtactcagccaagactggttatcaacaacttgggacaaga |
202 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37565506 |
gcattttatgtataactcttgtatcgatattttgatttagaatgctagtgcagatgcagtgtactcagcaaagactggttatcaacaacttgggacaaga |
37565605 |
T |
|
| Q |
203 |
gttacaagacggtggttattgagtcagactccaaaatgttt |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37565606 |
gttacaagacggtggttattgagtccgactccaaaatgttt |
37565646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 34 - 145
Target Start/End: Complemental strand, 37161528 - 37161416
Alignment:
| Q |
34 |
gttccaactagcccaaatactatacttgagcttggttatgtagacatcaacaactagttttgatttggagca-ttttatgtataactcttgtaccgatgt |
132 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||||||| ||||||| || | |||||||| |||| |
|
|
| T |
37161528 |
gttccaactagcccaaatattataccagagcttggttatgtagacatcagcaattagttttgatttggagcatttttatggatgaatcttgtactgatgc |
37161429 |
T |
|
| Q |
133 |
tttgatttagaat |
145 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
37161428 |
tttgatttggaat |
37161416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 34 - 145
Target Start/End: Complemental strand, 37206094 - 37205982
Alignment:
| Q |
34 |
gttccaactagcccaaatactatacttgagcttggttatgtagacatcaacaactagttttgatttggagca-ttttatgtataactcttgtaccgatgt |
132 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||| ||| |||||||||||||||||| ||||||| || | |||||||| |||| |
|
|
| T |
37206094 |
gttccaactagcccaaatattataccagagcttggttatgtagacatcagcaattagttttgatttggagcatttttatggatgaatcttgtactgatgc |
37205995 |
T |
|
| Q |
133 |
tttgatttagaat |
145 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
37205994 |
tttgatttggaat |
37205982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University