View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14673_low_11 (Length: 293)
Name: NF14673_low_11
Description: NF14673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14673_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 39553864 - 39554045
Alignment:
| Q |
8 |
atgaagccaaagttgttgactggaagctgaaggaaactgaaccaaaacatgattaatgtttttaaccatgagcatataaagatctcatttgttgtaacct |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39553864 |
atgaaggcaaagttgttgactggaagctgaagcaaactgaaccaaaacatgattaatgtttttaaccatgaccatataaagatctcatttgttgtaacct |
39553963 |
T |
 |
| Q |
108 |
aattaagcaaatggactgagcctgtaatggaatgaatgatccgaaaagatggcgttctccctagcgcaagacgtgtcagaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39553964 |
aattaagcaaatggactgagcctgtaatggaatgaatgatccgaaaagatggcgttttccctagcgcaagacgtgtcagaac |
39554045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University