View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14674_high_13 (Length: 316)
Name: NF14674_high_13
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14674_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 139 - 304
Target Start/End: Complemental strand, 33620115 - 33619952
Alignment:
| Q |
139 |
ttattgaagatttcatgaaaatcaatgtagctatactgccaaagtataattttgnnnnnnnnnnnactttctcaaaaacagttttgtgttaaacttgcaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
33620115 |
ttattgaagatttcatgaaaatcaatgtagctatactgccaaagtataatttttttttttcttt--ctttctcaaaaacagttttgtgttaaacatgcaa |
33620018 |
T |
|
| Q |
239 |
atggtcattgctaactcaaagaaaaaattgaaaagattggagctggctgaattacaaacctatgtc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33620017 |
atggtcattgctaactcaaagaaaaaattgaaaagattggagctggctgaattacaaacctatgtc |
33619952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33620253 - 33620225
Alignment:
| Q |
1 |
acatgattaacggtttcatatcagctggg |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33620253 |
acatgattaacggtttcatatcagctggg |
33620225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University