View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14674_low_23 (Length: 233)
Name: NF14674_low_23
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14674_low_23 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 29197804 - 29197589
Alignment:
| Q |
14 |
tgtattgaatagagtgtgtatgcaattgtttgttatgggaaaagnnnnnnnnnntaatgcatcaaatttattgcaagtaaaagcaaaacttaaaacatcc |
113 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29197804 |
tgtattgaatagagtgtgtacgcaattgtttgttatgggaaga----aaaaaaataatgcatcaaatttattgcaagtaaaagcaaaacttaaaacatcc |
29197709 |
T |
 |
| Q |
114 |
agaccactttattaaaagttctttttggtatatcttgtactggacgaacttattcttgattggtaatatatttcattttgcattttttaaagaaaatatt |
213 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29197708 |
agaccactttactaaaagttttttttggtatatcttgtactggacgaacttattcttgattggtaatatatttcattttgcattttttaaagaaaatatt |
29197609 |
T |
 |
| Q |
214 |
gtttgaaaattttcttatga |
233 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29197608 |
gtttgaaaattttcttatga |
29197589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University