View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14674_low_25 (Length: 222)
Name: NF14674_low_25
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14674_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 206
Target Start/End: Original strand, 5917849 - 5918029
Alignment:
| Q |
22 |
tcaaaatcaccactctttattagacgaagggaaagaaactagagttttagtgaccgttcatacaagagaaggagaaaagagagagctattcttttcttaa |
121 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| | ||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
5917849 |
tcaaaatcacccctctttattagatgaagggaaatatactagagttttggtgacggttcatacaagagaag-agaaaagagagagctattctttt---aa |
5917944 |
T |
|
| Q |
122 |
aatatttatagttgttgtttggacaatgccctagactttacctagcaccttggcgatggaacacataatatttagtcagaataat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5917945 |
aatatttatagttgttgtttggacaatgccctagactttacctagcaccttggcgatggaacacataatatttggtcagaataat |
5918029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 105
Target Start/End: Complemental strand, 15665539 - 15665457
Alignment:
| Q |
25 |
aaatcaccactctttattagacgaagggaaagaaactagagttttagtgaccgttcataca--agagaaggagaaaagagaga |
105 |
Q |
| |
|
|||||||| |||||| || || ||||||||||||||||||||||| ||||| | | | ||| |||||||||||| ||||||| |
|
|
| T |
15665539 |
aaatcacccctctttgttggatgaagggaaagaaactagagttttggtgacggcttacacaagagagaaggagaagagagaga |
15665457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University