View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14674_low_26 (Length: 205)

Name: NF14674_low_26
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14674_low_26
NF14674_low_26
[»] chr4 (1 HSPs)
chr4 (24-205)||(25569198-25569379)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 24 - 205
Target Start/End: Original strand, 25569198 - 25569379
Alignment:
24 tattggtgatgaaaatgaatccagctcttcagaagtggaacacatggacgaaaatattagcactgctaggtgttgtggattgatcaaatatagtttcaga 123  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25569198 tattggtgatgaaaatgaatctagctcttcagaagtggaacacatggacgaaaatattagcactgctaggtgttgtggattgatcaaatatagtttcaga 25569297  T
124 cagtggattgcaaatttcttgtgtagattagtggagtgctgggggtagtcaaattgttggacttgatcttgattctgaagct 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25569298 cagtggattgcaaatttcttgtgtagattagtggagtgctgggggtagtcaaattgttggacttgatcttgattctgaagct 25569379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University