View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14674_low_26 (Length: 205)
Name: NF14674_low_26
Description: NF14674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14674_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 24 - 205
Target Start/End: Original strand, 25569198 - 25569379
Alignment:
| Q |
24 |
tattggtgatgaaaatgaatccagctcttcagaagtggaacacatggacgaaaatattagcactgctaggtgttgtggattgatcaaatatagtttcaga |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25569198 |
tattggtgatgaaaatgaatctagctcttcagaagtggaacacatggacgaaaatattagcactgctaggtgttgtggattgatcaaatatagtttcaga |
25569297 |
T |
 |
| Q |
124 |
cagtggattgcaaatttcttgtgtagattagtggagtgctgggggtagtcaaattgttggacttgatcttgattctgaagct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25569298 |
cagtggattgcaaatttcttgtgtagattagtggagtgctgggggtagtcaaattgttggacttgatcttgattctgaagct |
25569379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University