View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14675_high_4 (Length: 261)
Name: NF14675_high_4
Description: NF14675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14675_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 51 - 247
Target Start/End: Complemental strand, 48967381 - 48967185
Alignment:
| Q |
51 |
ccaacacaattggagaaattgagtggcttaattgatttgaattaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
150 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967381 |
ccaacacaattggagaaattgagtagtttaattgatttgaactaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
48967282 |
T |
|
| Q |
151 |
atcggtgaacgcattatgattcatggtataattacaacaacaattgtgttgcgttcaccgatcatacaaaaattgtgtatactacctaaagtgtgat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967281 |
atcggtgaacgcattatgattcatggtataattacaacaacaattgtgttgcgttcaccgatcatacaaaaattgtgtatactacctaaagtgtgat |
48967185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 48967872 - 48967820
Alignment:
| Q |
1 |
cttaaggctaagagactaaaggattgggcttaggtttctacctagcgtgtcca |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
48967872 |
cttaaggctaagagactaaaggattgggcttaggtttctatctagcatgtcca |
48967820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University