View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14675_low_6 (Length: 229)
Name: NF14675_low_6
Description: NF14675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14675_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 30922051 - 30922254
Alignment:
| Q |
10 |
tttatttatttattagagaaatctaaagtatagcaacatagttacctccttgcagttgtaaggggcaccatcttctgataaatatctgcgctcataatag |
109 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30922051 |
tttatttatttattagagaaatcttaagtataccaacattgttacctccttgcagttgtaaggggcaccatcttctgataaatatctgcgctcataatag |
30922150 |
T |
 |
| Q |
110 |
agaagtttcctatgatgttcctcttcatcattttttgcatcgcgggtagctctagattgacatggcagcattaagtctgtcgcgttggaaggcatgcata |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
30922151 |
agaagtttcctatgatgttcatcttcatcattttttgcatcgcgggtagctctagattgacatggcagcattatgtctgtcgcattggcaggcatgcata |
30922250 |
T |
 |
| Q |
210 |
attt |
213 |
Q |
| |
|
|||| |
|
|
| T |
30922251 |
attt |
30922254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University