View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14677_low_11 (Length: 234)
Name: NF14677_low_11
Description: NF14677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14677_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 16508173 - 16508090
Alignment:
| Q |
92 |
ctaggtcatggttgtatccctcctagagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgctcgaggaagttaactc |
175 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16508173 |
ctaggtcatggttgtatccctcctggagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgctcgaggaagttaactc |
16508090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 16508329 - 16508274
Alignment:
| Q |
104 |
tgtatccctcctagagtcttgaagtgcactcaggatgggtgtcgatgtgaaggtgc |
159 |
Q |
| |
|
|||||| || |||||||| ||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
16508329 |
tgtatctcttctagagtcatgaggtgcactgagaatgggtgtcgatgtgaaggtgc |
16508274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University