View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14677_low_14 (Length: 201)

Name: NF14677_low_14
Description: NF14677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14677_low_14
NF14677_low_14
[»] chr1 (1 HSPs)
chr1 (11-183)||(47988543-47988715)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 47988543 - 47988715
Alignment:
11 agcaaaggtagaaattaaaaatggcattacagcatgtggtagaaacatggtggatataaataaccnnnnnnnnnnnnnn--gtgcagaaaagtatcaaca 108  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                |||||||||||||||||||    
47988543 agcaagggtagaaattaaaaatggcattacagcatgtggtagaaacatggtggatataaataaccaaaaaaaaaaaaaaaagtgcagaaaagtatcaaca 47988642  T
109 tatgagaagagcattgtatggataatgataaattactaaccagtgtggtctccaaaattaaacttgtatgctctt 183  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
47988643 tatgagaagagcattgtatggataatgataaattactaacca--gtggtctccaaaattaaacttgtatgctctt 47988715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University