View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14677_low_8 (Length: 319)
Name: NF14677_low_8
Description: NF14677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14677_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 7965695 - 7965880
Alignment:
| Q |
1 |
attgcatttagaaattcnnnnnnncatataaagtaggttcagcttttgaccagaacaactgcagttgtagtgtgtactgatgaacttttgtcaattattt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7965695 |
attgcatttagaaattcaaaaaaacatataaagtaggttcagcttttgaccagaacaactgcagttgtagtgtgtactgatgaacttttctcaattattt |
7965794 |
T |
|
| Q |
101 |
tcctagttacttaccattgcttagttttgaagggaaactttgcagttccttattacccttttactacccaacgtttccaatgttaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7965795 |
tcctagttacttaccattgcttagttttgaagggaaactttgcagttccttattacccttttactacccaacgtttccaatgttaa |
7965880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 254 - 304
Target Start/End: Original strand, 7965947 - 7965997
Alignment:
| Q |
254 |
atatgtttagagttaataaccttgaaattaacaaggttagctatggtgagt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7965947 |
atatgtttagagttaataaccttgaaattaacaaggttaactatggtgagt |
7965997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University