View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14678_low_19 (Length: 227)
Name: NF14678_low_19
Description: NF14678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14678_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 12268886 - 12268669
Alignment:
| Q |
1 |
tcatcacaacgcattgttttacttgactaactaccataactcttctagctatttatcttttctgaatctggactaaaattctccagtttgtgatgtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268886 |
tcatcacaacgcattgttttacttgactaactaccataactcttctagctatttatcttttctgaatctggactaaaattctccagtttgtgatgtttta |
12268787 |
T |
|
| Q |
101 |
gattttgcagatgactcacccaaaaagatatttgcattagacctttatt-ttttatagcaaacgattctataaaataatttataatttattagtaataaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268786 |
gattttgcagatgactcacccaaaaagatatttgcattagacctttatttttttatagcaaacgattctataaaataatttataatttattagtaataaa |
12268687 |
T |
|
| Q |
200 |
tgaaaatattgatatggg |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12268686 |
tgaaaatattgatatggg |
12268669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 227
Target Start/End: Complemental strand, 12270276 - 12270203
Alignment:
| Q |
154 |
atagcaaacgattctataaaataatttataatttattagtaataaatgaaaatattgatatggggggatgggta |
227 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||| |||||||||||||||| |||||||| ||| |||| |
|
|
| T |
12270276 |
atagccaacgattctttaaagtaatttataatttattgcaaataaatgaaaatatttatatggggtgattggta |
12270203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University