View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14678_low_20 (Length: 223)
Name: NF14678_low_20
Description: NF14678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14678_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 48991180 - 48990987
Alignment:
| Q |
10 |
cgagagagaagaaaccgagagccattatgaagagaaatgcgatgaaccagttacgttgccaaatcggaagctccgattcggaatggatcgtggattctct |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48991180 |
cgagagcgaagaaaccgagagccattatgaagagaaatgcgatgaaccagttacgttgccaaatcggaagctccgattcggaatggatcgtggattctct |
48991081 |
T |
 |
| Q |
110 |
gtatataattcgggtcgacccggtttgtgattgttgcgaagatgaagaagagggttttcttcgtgataatcctccctgctgtgaacctgaggaa |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48991080 |
gtatatgattcgggtcgacccggtttgtgattgttgcgaagatgaagaagagggttttcttcgtgataatcctccctgctgtgaacctgaggaa |
48990987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University