View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1467_high_9 (Length: 216)
Name: NF1467_high_9
Description: NF1467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1467_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 9910553 - 9910746
Alignment:
| Q |
19 |
atgaacgacgatgcaagctctcaaagctcaacgaattccttcaagtctttcaattaccattgca------------atgaagatgaccaaggtacaaatc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9910553 |
atgaacgacgatgcaagctctcaaagctcaacgaattccttcaagtctttcaattaccattgcaatgattcatgcaatgaagatgaccaaggtacaaatc |
9910652 |
T |
 |
| Q |
107 |
tagtagtaggagaagaacctctttgttgcaatccaaagagtcacaacaaatggacaagatttggtcctccagaagagatggtggaggctggttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9910653 |
aagtagtaggagaagaacctctttgttgcaatccgaagagtcacaacaaatggacaagatttggtcctccagaagagatggtggaggctggttt |
9910746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University