View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14680_high_14 (Length: 219)
Name: NF14680_high_14
Description: NF14680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14680_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 21 - 203
Target Start/End: Complemental strand, 44546672 - 44546490
Alignment:
| Q |
21 |
acgatttgtttgaacattacgtctctttccaccaagtttaccctttttctttgttgcacatgatgattcatnnnnnnnatattttacatacacatcatcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44546672 |
acgatttgtttgaacattacgtctctttccaccaagtttatcctttttctttgttgcacatgatgattcatcccccccatattttacatacacatcatcc |
44546573 |
T |
|
| Q |
121 |
tcaactatctcaagtacattagattttccatgacgcttcatatgcttcattaaaaacctatgtcgttcattttcttcttcatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44546572 |
tcaactatctcaagtacattagattttccatgacgcttcatatgcttcaataaaaacctatgtcgttcattttcttcttcatt |
44546490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University