View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14680_low_14 (Length: 249)
Name: NF14680_low_14
Description: NF14680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14680_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 44372470 - 44372712
Alignment:
| Q |
1 |
cccatagaaacagaaactctctccttaacatcatcaccttctttttccacaacagttacttttcttgacttttcaacctcaaccaccttcttctcattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44372470 |
cccatagaaacagaaactctctccttaacatcaccaccttctttttccacaacagttacttttcttgacttttcaacctcaaccacctttttctcattct |
44372569 |
T |
|
| Q |
101 |
ttaacaacccctgaagtttccacctttctaattctgaactaggtttttgaggtggtttctctttaagggtcctcttagaatgcnnnnnnncactctcttt |
200 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
44372570 |
tcaacaacccctgaagtttccacctttccaattctgaactaggtttttgaggtggtttctctttaagggtcttcttagaatgcaaaaaaacactctcttt |
44372669 |
T |
|
| Q |
201 |
ttcatgatttggtgttagtactgtgattttcgtttggtctgtg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44372670 |
ttcatgatttggtgttagtactgtgattttcgtttggtgtgtg |
44372712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University