View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14680_low_17 (Length: 217)
Name: NF14680_low_17
Description: NF14680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14680_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 200
Target Start/End: Original strand, 6352132 - 6352323
Alignment:
| Q |
9 |
aattgaccattagcatggcctagctagcataccaaatggatttacttgataccaaagtagaatcatatgttgcattttattacaaatgacagaattatta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6352132 |
aattgaccattagcatggcctagctagcataccaaatggatttacttgataccaaagtagaatcatagtttgcattttattacaaatgacagaattatta |
6352231 |
T |
 |
| Q |
109 |
tttgacgtaacgcctaaagtataaggagatgaatgcactgagagcttagtcacatggcaggaagatcctttgataacattgagatgtgagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6352232 |
tttgacgtaacgcctaaagtataaggagatgaatgcagtgagagcttagtcacatggcaggaagatcctttgataacattgagatgtgagaa |
6352323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University