View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_high_7 (Length: 360)
Name: NF14681_high_7
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 344
Target Start/End: Complemental strand, 46072778 - 46072453
Alignment:
| Q |
19 |
gactcacctgtgaaaataccaaggactgtacgaaaggcatcatcatcgaatggtggcgtgccattttgggacaggaacgctgcaggtaagtctgatgaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46072778 |
gactcacctgtgaaaataccaaggactgtacgaaaggcaccatcattgaatggtggcgtgccattttgggacaggaacgctgctggtaagtctgatgaat |
46072679 |
T |
 |
| Q |
119 |
ctgtcagtaaggagcctgaagtgtgtgaagatagaagaaggccacggcagaaaagaacacaggaggaaaaagagaacaacagacgctgattaatatccgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072678 |
ctgtcagtaaggagcctgaagtgtgtgaagatagaagaaggccacggcagaaaagaacacaggaggaaaaagagaacaacagacgctgattaatatccgt |
46072579 |
T |
 |
| Q |
219 |
ttgttacccttttcggctacatttgtatatataccaaaaaagccacaaggagttagtgtaatgtttagaaaattgatcttcctttgcctgcagcagataa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072578 |
ttgttacccttttcggctacatttgtatatataccaaaaaggccacaaggagttagtgtaatgtttagaaaattgatcttcctttgcctgcagcagataa |
46072479 |
T |
 |
| Q |
319 |
acaaggacatagatgaattgcattga |
344 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
46072478 |
acagggacatagatgaattgcattga |
46072453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University