View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_low_17 (Length: 255)
Name: NF14681_low_17
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 52769672 - 52769466
Alignment:
| Q |
20 |
gattactctttggctacgacactggtacgtatcttatgaattatatattctctcaataacaataacaataacaataacattatgattcttgttttgttca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
52769672 |
gattactctttggctacgacactggtacgtatcttatgaattatatattctctcaataacaataacaataaca------tgatgattcttgttttgttca |
52769579 |
T |
 |
| Q |
120 |
ggtgttatatcaggtgctctcctctatattaaagatgactttcaggccgtcagatacagtcattttcttcaggtatctttcttcttttcacattctcact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52769578 |
ggtgttatatcaggtgctctcctctatattaaagatgactttcaggccgtcagatacagtcattttcttcaggtatctttcttcttttcacattctcact |
52769479 |
T |
 |
| Q |
220 |
aatcaatcaatca |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52769478 |
aatcaatcaatca |
52769466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University