View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_low_2 (Length: 442)
Name: NF14681_low_2
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 175 - 398
Target Start/End: Complemental strand, 36932584 - 36932361
Alignment:
| Q |
175 |
gacattgtatgagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacg |
274 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36932584 |
gacattgtaagagaaaataagttcaaacatgaaagatcaggagattaactgttccatggctttgagccaaacgggctcggccttggccaaacccttgacg |
36932485 |
T |
|
| Q |
275 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgtctctt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36932484 |
agctttctggaccgagaaagcaaatctcctttcataaacgacattgttcccacttctttgattttcgttctctgttgctagttgcttcaatgcgcctctt |
36932385 |
T |
|
| Q |
375 |
gctgttgcaggcaacaaaacaaaa |
398 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36932384 |
gctgttgcaggcaacaaaacaaaa |
36932361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 78 - 141
Target Start/End: Complemental strand, 36932661 - 36932598
Alignment:
| Q |
78 |
accattgtgcagcaaaaagagtcatcaacgataaaaatctagataggagattctcaagtggcac |
141 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36932661 |
accattgtgcaacaaaaagagtcatcaaagataaaaatctagataggagattctcaagtggcac |
36932598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 220 - 331
Target Start/End: Complemental strand, 990422 - 990311
Alignment:
| Q |
220 |
taactgttccatggctttgagccaaacgggctcggccttggccaaacccttcacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
319 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
990422 |
taactgttccatggctttgagccaaacaggttcggccatggccaaacccttgacgagctttctggaccgagaaagcaaatctcctttcataaacgacatt |
990323 |
T |
|
| Q |
320 |
gttcccacttct |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
990322 |
gttcccacttct |
990311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University