View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_low_23 (Length: 238)
Name: NF14681_low_23
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 55643 - 55439
Alignment:
| Q |
15 |
cacagacatatagacactgatagtaatataaaataaggtgattgtatgtaatcataagtctcaacgtttgacattgagacatgtgagtgtcagacattgg |
114 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55643 |
cacagacatatagacaccgatagtaataaaaaataaagtgattgtatgtaatcataagtgtcaacgtttgacactgagacatgtgagtgtcagacattgg |
55544 |
T |
|
| Q |
115 |
catgtgtctgacacctgaacacaccttcaatttgaagtgtcggtattactttccaaatcatttctaggtttaaatatttattgttgtcattattttggtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55543 |
catgtgtctgacacctgaacacacctttaatttgaagtgtcggtattactttccaaatcatttctaggtttaaatatttattgttgtcattattttggtg |
55444 |
T |
|
| Q |
215 |
ggcat |
219 |
Q |
| |
|
||||| |
|
|
| T |
55443 |
ggcat |
55439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 158
Target Start/End: Complemental strand, 22882589 - 22882560
Alignment:
| Q |
129 |
ctgaacacaccttcaatttgaagtgtcggt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22882589 |
ctgaacacaccttcaatttgaagtgtcggt |
22882560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University