View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_low_24 (Length: 237)
Name: NF14681_low_24
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33116230 - 33116452
Alignment:
| Q |
1 |
gctaaggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgctcaaaatgcaattggagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116230 |
gctaaggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgctcaaaatgcaattggagtg |
33116329 |
T |
|
| Q |
101 |
agaaatgtgcttatgcttttgggtgtggccaatttcttggggatgatgtttacattcttggttcctgaatctaaaggaaaatctttggaagaaatttctg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116330 |
agaaatgtgcttctgcttttgggtgtggccaatttcttggggatgatgtttacattcttggttcctgaatctaaaggaaaatctttggaagaaatttctg |
33116429 |
T |
|
| Q |
201 |
gtgaagctgaggaagaaactttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33116430 |
gtgaagctgaggaagaaactttg |
33116452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 82
Target Start/End: Complemental strand, 16174271 - 16174192
Alignment:
| Q |
3 |
taaggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgct |
82 |
Q |
| |
|
||||||| || |||||||| ||||| |||||||| ||||| || |||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
16174271 |
taaggtctacctgtcatggaatatcagctgctgcaggaaaggcaggagcaattgttggtgcatttggattcttgtatgct |
16174192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 16185089 - 16185170
Alignment:
| Q |
1 |
gctaaggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgct |
82 |
Q |
| |
|
||||||||| || |||||||| || || |||||||| ||||| || |||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
16185089 |
gctaaggtctacctgtcatggaatctcagctgctgcaggaaaggcaggagcaattgttggtgcatttggattcttgtatgct |
16185170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 82
Target Start/End: Original strand, 16224481 - 16224560
Alignment:
| Q |
3 |
taaggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgct |
82 |
Q |
| |
|
||||||| || |||||||| || || |||||||| ||||| || |||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
16224481 |
taaggtctacctgtcatggaatctcagctgctgcaggaaaggcaggagcaattgttggtgcatttggattcttgtatgct |
16224560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 37314852 - 37314775
Alignment:
| Q |
5 |
aggtcaacatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttggtttcttgtatgct |
82 |
Q |
| |
|
||||| |||||||||||||||||| |||| || || |||||||||||||| ||||||| ||||| ||||| |||||| |
|
|
| T |
37314852 |
aggtctacatgtcatggtatatcctctgcagcagggaaagctggagcaattataggtgcatttggattcttatatgct |
37314775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 69
Target Start/End: Complemental strand, 28816697 - 28816639
Alignment:
| Q |
11 |
acatgtcatggtatatccgctgctgctggaaaagctggagcaatggtaggtgcttttgg |
69 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| | ||||| || || ||||||||||| |
|
|
| T |
28816697 |
acatgtcatgggatatccgctgcagctggaaaatcaggagctatagtcggtgcttttgg |
28816639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University