View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14681_low_7 (Length: 386)
Name: NF14681_low_7
Description: NF14681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14681_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 35211036 - 35211199
Alignment:
| Q |
1 |
ttcactacatcttaactgttttctt-gtctttttgtgtatgagagtttgtgtgaggttccaatacaaattccaaaaccttacaccttcct-tcatcgtga |
98 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35211036 |
ttcactacatcttaactgttttttttgtctttttgtgtatgagagtttgtgtgaggttccaatacaaattccaaaacctaacaccttcctgtcatcgtga |
35211135 |
T |
 |
| Q |
99 |
aatactccctccttaacgaaatttaagtaaaaataatggtcgaaaaattgatgtagtatacgaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35211136 |
aatactccctccttaacgaaatttaagtaaaaataatggtcgaaaaattgatgtagaatacgaa |
35211199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 330 - 378
Target Start/End: Original strand, 35211370 - 35211418
Alignment:
| Q |
330 |
tttatttatatattagatcggagaaaatacgtgttgtggtgagctgttc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35211370 |
tttatttatatattagatcggagaaaatacgtgttgtggtgagctgttc |
35211418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University