View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_high_15 (Length: 321)
Name: NF14682_high_15
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 24 - 129
Target Start/End: Complemental strand, 33640902 - 33640797
Alignment:
| Q |
24 |
aatgtaatcggtagaatatgtttgaaattgtgggtaggttcagaaataacaaggaggaatgaatgaaccctctttattgattgctgttgttatgaataag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33640902 |
aatgtaatcggtagaatatgtttgaaattgtgggtaggttcagaaataacaaggaggaatgaatgaaccctctttattgattgctgttgttatgaataag |
33640803 |
T |
|
| Q |
124 |
gaaggt |
129 |
Q |
| |
|
|||||| |
|
|
| T |
33640802 |
gaaggt |
33640797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 170 - 302
Target Start/End: Complemental strand, 33640741 - 33640601
Alignment:
| Q |
170 |
tgtccaattgtggttgtgaatttttgtttatttaatgatgagaaatgggaaatgattgggaacttattatgaagaaagag--------agagagggtgat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
33640741 |
tgtccaattgtggttgtgaatttttgtttatttaatgatgagaaatgggaaatgattgggaacttattatgaagagagagagagagaaagagagggtgat |
33640642 |
T |
|
| Q |
262 |
gaattgattgatgacataacaaacaaaggaggagtaaacac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33640641 |
gaattgattgatgacataacaaacaaaggaggaggaaacac |
33640601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University