View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_high_26 (Length: 249)
Name: NF14682_high_26
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_high_26 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 62 - 249
Target Start/End: Original strand, 40780395 - 40780582
Alignment:
| Q |
62 |
tactaattgtcctaacaaatcaaaacattctgatataaaacactggcaaaagaaagttcaacaataaatttcgttttcaagagagaaagaatttctaaaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40780395 |
tactaattgtcctaacaaatcaaaacattctgatataaaacactggcaaaagaaagttcaacaataaatttcgttttcaagagagagagaatttctaaaa |
40780494 |
T |
|
| Q |
162 |
gataaattggtgaatcaatgccaaaaaatcagaactgttcattacaatcaactagctaatnnnnnnnntagttacattataaataatc |
249 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40780495 |
gatatatcggtgaatcaatgccaaaaaatcagaactgttcattacaatcaactagctaataaaaaaaatagttacattataaataatc |
40780582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 40780209 - 40780250
Alignment:
| Q |
18 |
atccacgaccacaactttcataaggtgtgtctatatataata |
59 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40780209 |
atccacaaccacaactttcataaggtgtgtctatatataata |
40780250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University