View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_high_36 (Length: 226)
Name: NF14682_high_36
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 720317 - 720536
Alignment:
| Q |
1 |
tccataccctcacgacataccacaagacgagcatacagtgggtgctgatctggttgattaacttcttgcatcatcactctttcaatgatatctccaaatt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
720317 |
tccataccctcacgacgtaccacaagacgagcatacaatgggtgctgatctggttgattaacttcttgcatcatcactctttcaatgatatctccaaatt |
720416 |
T |
 |
| Q |
101 |
ctctgcttggatagcaaaaataggtaaagagaaattaggaagctacattggcacgatatcaacatcacataacttgtttttcattaaaattcaaatgnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
720417 |
ctctgcttggatagcaaaaataggtaaagagaaattaggaagctacattggcacgatatcaacatcacataacttgtttttcattaaaattcaagtgttt |
720516 |
T |
 |
| Q |
201 |
nnnnctctctaattaatagt |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
720517 |
ttttctctctaattaatagt |
720536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University