View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_high_39 (Length: 205)
Name: NF14682_high_39
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 20746764 - 20746828
Alignment:
| Q |
1 |
tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20746764 |
tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag |
20746828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 20746905 - 20746953
Alignment:
| Q |
142 |
attgtgttagttgttgctacataatttttagtagttactagtttttatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20746905 |
attgtgttagttgttgctacataatttttagtagttactagtttttatt |
20746953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 25815680 - 25815744
Alignment:
| Q |
1 |
tgtcaccattttttgttgctgtgatttcatcagtacgtaggggtgatctttttgggttgtaatag |
65 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25815680 |
tgtcaccattttttgttgctgtgttttcatcagtacgcaggggtgatctttttgggttgtaatag |
25815744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 25815821 - 25815869
Alignment:
| Q |
142 |
attgtgttagttgttgctacataatttttagtagttactagtttttatt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25815821 |
attgtgttagttgttgctacataatttttagtagttactagtttttatt |
25815869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University