View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_low_24 (Length: 297)
Name: NF14682_low_24
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 3710446 - 3710181
Alignment:
| Q |
18 |
ttttgtgggtcgttgatagagtttattcttgggaacacgctcgaatgcatatgattccctttgttaggatgtcgatgaatgtattggtgtacctttgtca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710446 |
ttttgtgggtcgttgatagagtttattcttgggaacacgctcgaatgcatatgattccctttgttaggatgtcgatgaatgtattggtgtacctttgtca |
3710347 |
T |
 |
| Q |
118 |
gtgccgtggatgaatgatttagagtcctttcatcttggggtttaagaagaataacttataggcctttcatcttggggtcgaggaaaattaattttgaggg |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710346 |
gggccgtggatgaatgatttagagtcctttcatcttggggtttaagaagaatagcttataggcctttcatcttggggtcgaggaaaattaattttgaggg |
3710247 |
T |
 |
| Q |
218 |
ctttgagcttgcggtggtggaataacggtttcgaggcctttgcgcttggggttgtggaagaataat |
283 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3710246 |
ctttgagcttgtggtggtggaataacggtttcgaggcctttgcgcttggggttgtggaagaataat |
3710181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University