View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_low_36 (Length: 240)
Name: NF14682_low_36
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 30874594 - 30874800
Alignment:
| Q |
19 |
aaagagagagacagagaaacaaataaagtggtggaacttgcgaccattctcacaactaggaaagtattcataacaataaaatattcatggtgggattaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874594 |
aaagagagagacagagaaacaaataaagtggtggaacttgcgaccattctcacaactaggaaagtattcataacaataaaatattcatggtgggattaaa |
30874693 |
T |
 |
| Q |
119 |
caatgtaagtt--tatttatttattaatctctttgaaaaccacattaattatagttaattgtagacttttaaaatcatgggatgaagttaaattgttgtg |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874694 |
caatgtaagtttatatttatttattaatctctttgaaaactacattaattatagttaattgtagacttttaaaatcatgggatgaagttaaattgttgtg |
30874793 |
T |
 |
| Q |
217 |
tctatat |
223 |
Q |
| |
|
||||||| |
|
|
| T |
30874794 |
tctatat |
30874800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University