View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_low_38 (Length: 238)
Name: NF14682_low_38
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_low_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 30277478 - 30277700
Alignment:
| Q |
16 |
gttgaagtgatgattatgttatttataaaagaaaatgaattatatatgaaagtatacccttccagtgatggattcaatatcaagtttggcattgtcatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30277478 |
gttgaagtgatgattatgttatttataaaataaaatgaattatatatgaaagtatacccttcctgtgatggattcaatatctagtttggcattgtcatca |
30277577 |
T |
 |
| Q |
116 |
ggttgatcaatactgttattagaattagaaagtgagaggacggaaaccacgtcgtcggagctcggctctgaagagtgtatcgagtttcgaggctccggga |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30277578 |
ggtcgatcaatactgttattagaattagaaagtgagaggacggaaaccacgtcgtcggagctcggctctgaagagtgtatcgagtttcgaggctccggga |
30277677 |
T |
 |
| Q |
216 |
gtgagtggtctctgaaccggaac |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30277678 |
gtgagtggtctctgaaccggaac |
30277700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University