View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14682_low_39 (Length: 238)
Name: NF14682_low_39
Description: NF14682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14682_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 45521487 - 45521268
Alignment:
| Q |
18 |
cagcgttgagaaatggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521487 |
cagcgttgagaaatggacatgatcattgttattatcatctatggaagagtctaccaacacaaccttatgatcattgttgttcaacaaatctttgactttg |
45521388 |
T |
|
| Q |
118 |
tcatagtaacattgttgtgttatgataagcttggtgttggaggatattgcttgctttccaatctcagcagccgtgaagaaaggattggcggcagtggcta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
45521387 |
tcatagtaacattgttgtgttatgataagcttggtgttggaggattttgcttgctttccaatctcagaagccgtgaagaaaggattggctgcagtggcta |
45521288 |
T |
|
| Q |
218 |
cagcgccgagataagaagca |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45521287 |
cagcgccgagataagaagca |
45521268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University