View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14683_low_14 (Length: 249)
Name: NF14683_low_14
Description: NF14683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14683_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 6 - 245
Target Start/End: Complemental strand, 17553866 - 17553627
Alignment:
| Q |
6 |
agaaacctcattggaaacaattgttcggagtttccaagattcaatgtcagtaacaaaacagcacaaattctgggaaacacaacctgttggtcaatacaaa |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17553866 |
agaaacctcgttggaaacaattgttcggagtttccaagattcaatgtcagtaaccaaacaacacaaattctgggaaacacaacctgttggtcaatacaaa |
17553767 |
T |
 |
| Q |
106 |
gatgttggtgacacaaccctaccagaaggaccaattgaaccaccaaaacccttatcagaagtcaaacaagaaccttataatcttccaaatctatatgaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17553766 |
gatgttggtgacacaaccctaccagaaggaccaattgaaccaccaaaacccttatcagaagtcaaacaagaaccttataatcttccaaatttatatgaat |
17553667 |
T |
 |
| Q |
206 |
ggacaacatgtgatatgggttgtcaagaaacatgtgatga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17553666 |
ggacaacatgtgatatgggttgtcaagaaacatgtgatga |
17553627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University