View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14683_low_17 (Length: 241)
Name: NF14683_low_17
Description: NF14683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14683_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 5218698 - 5218493
Alignment:
| Q |
22 |
caggtttggatgcctcttctacgtaaagaatgcaggccacccttccattgtgggtccacgccgttgctgaggtgacattgcagctcatgttcaccaacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218698 |
caggtttggatgcctcttctacgtaaagaatgcaggccacccttccattgtgggtccacgccgttgctgaggtgacattgcagctcatgttcaccaacac |
5218599 |
T |
 |
| Q |
122 |
cgctgatatttctgatagtaggcctggtctatccatcccactcatctccaatgctgtgttctccgttgacacaatttgttttgagtattttgactgtgaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218598 |
tgctgatatttctgatagtaggcctggtctatccatcccactcatctccaatgctgtgttctccgttgacacaatttgttttgagtattttgactgtgaa |
5218499 |
T |
 |
| Q |
222 |
tattct |
227 |
Q |
| |
|
|||||| |
|
|
| T |
5218498 |
tattct |
5218493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University