View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14683_low_2 (Length: 572)
Name: NF14683_low_2
Description: NF14683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14683_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 1e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 26679298 - 26679145
Alignment:
| Q |
1 |
gaatcttgatccctaagttagatttcttatcttaaattctgatttgaagattgtgtgtaatagtgctacttctctaaacttattgacattattgtcacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26679298 |
gaatcttgatccctaagttagatttcttatcttaaattctgatttgtagattgtgtgtaatagtgctacttctctaaacttattgacattattgtcacat |
26679199 |
T |
 |
| Q |
101 |
tgccattaaaatggactgtatctgtttagtggatttgttttgagattgattatt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26679198 |
tgccattaaaatggactgtatctgtttagtggattcgttttgagattgattatt |
26679145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 218 - 309
Target Start/End: Complemental strand, 26679081 - 26678990
Alignment:
| Q |
218 |
tcatacaattgaattcaaaatattcatataaattgaatttagattaaagaattaaagtttattattcattgttacaaatgcttttatataaa |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
26679081 |
tcatacaattgagttcaaaatattcatataaattgaatcaagtttaaagaatcaaagtttattattcattgttacaaatacttttacataaa |
26678990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University