View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14683_low_24 (Length: 203)
Name: NF14683_low_24
Description: NF14683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14683_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 33833922 - 33833806
Alignment:
| Q |
20 |
atttgttcatatctgatgatannnnnnnngttccacagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgat |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33833922 |
atttgttcatatctgatgatattttttttgttccacagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgat |
33833823 |
T |
 |
| Q |
120 |
ggcaagtagcttctacc |
136 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33833822 |
ggcaagtagcttctacc |
33833806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 54 - 131
Target Start/End: Original strand, 43155717 - 43155794
Alignment:
| Q |
54 |
acagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgatggcaagtagctt |
131 |
Q |
| |
|
|||||| ||||| || || |||||||||||||||| ||| |||||| | |||||||| || ||||||||||||||||| |
|
|
| T |
43155717 |
acagccctgttcgatgggctttgccactggtggaagaacattctttctttggggaggctgtatgatggcaagtagctt |
43155794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 54 - 125
Target Start/End: Original strand, 43143611 - 43143682
Alignment:
| Q |
54 |
acagccttgttcaataggatttgccactggtggaaaaaccttctttttgtggggaggttgcatgatggcaag |
125 |
Q |
| |
|
|||||||||||| || || |||| |||| |||||| ||| |||||| |||||||||| || ||||||||||| |
|
|
| T |
43143611 |
acagccttgttcgatgggctttgacactagtggaagaacattctttctgtggggaggctgtatgatggcaag |
43143682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University