View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_high_12 (Length: 460)
Name: NF14684_high_12
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 28 - 238
Target Start/End: Complemental strand, 4326749 - 4326537
Alignment:
| Q |
28 |
ttgacaaattaaactatccctatacaaaaatacattatgttctcgtgcacaatttataaaagtgaagatgattcttatttggcgattgcctaagccctaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4326749 |
ttgacaaattaaactatccctatacaaaaatacattatgttctcgtgcacaatttataaaagtgaagatgattcttatttggtgattgcctaagccctaa |
4326650 |
T |
|
| Q |
128 |
acgatgtgt--gtgtatatagaggagtggtattcgtatctcttgtatatttggatttggataacacttgttattagtttgttatatcataacttgtgacg |
225 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4326649 |
acgatgtgtgtgtgtatatagaggagtggtattcgtatctcttgtagtattggaattggataacacttgttattagtttgttatatcataacttgtgacg |
4326550 |
T |
|
| Q |
226 |
caagttttgcatg |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4326549 |
caagttttgcatg |
4326537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 175 - 209
Target Start/End: Complemental strand, 4330038 - 4330004
Alignment:
| Q |
175 |
ttggatttggataacacttgttattagtttgttat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4330038 |
ttggatttggataacacttgttattagtttgttat |
4330004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University