View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_high_19 (Length: 422)
Name: NF14684_high_19
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 16 - 416
Target Start/End: Original strand, 32933756 - 32934156
Alignment:
| Q |
16 |
aatattacgataggtttacaccagatgaagaggcacttgatgaccaagaagagactggatggaagtatatccatggtgatgtgttcagatatccaagatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933756 |
aatattacgataggtttacaccagatgaagaggcacttgatgaccaagaagagactggatggaagtatatccatggtgatgtgttcagatatccaagatt |
32933855 |
T |
|
| Q |
116 |
taagtctttgttcgcagcagcacttggaacaggcactcagttatttacactgtgagtgaattaccttctcaaagtactaatggtattcatataatataat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32933856 |
taagtctttgttcgcagcagcacttggaacaggcactcagttatttacactgtgagtgaattaccttctcaaagtactaatggtattcatataatatagt |
32933955 |
T |
|
| Q |
216 |
gtttactcattttcatgttcagctcttttgtgactatatacttggcttccatttttcagtgtaatcttcatctttatgcttgctctagttggtgttttct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933956 |
gtttactcattttcatgttcagctcttttgtgactgtatacttggcttccatttttcagtgtaatcttcatctttatgcttgctctagttggtgttttct |
32934055 |
T |
|
| Q |
316 |
atccatacaacaggggagctttgtttactgcactggttgtcatatatgcattaacgtctggcattgccggttattctgccgcttccttctattacatgat |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32934056 |
atccatacaacaggggagctttgtttactgcactggttgtcatatatgcattaacgtctggcattgccagttattctgccgcttccttctattacatgat |
32934155 |
T |
|
| Q |
416 |
t |
416 |
Q |
| |
|
| |
|
|
| T |
32934156 |
t |
32934156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University