View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14684_high_58 (Length: 227)

Name: NF14684_high_58

Description: NF14684

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF14684_high_58

[»] chr1 (1 HSPs)

[»] chr5 (1 HSPs)

Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 119; E-Value: 6e-61

Query Start/End: Original strand, 5 - 171

Target Start/End: Complemental strand, 35402488 - 35402322

Alignment:

Q	5	tgaagagcaagatttaataaggaaatatgagatgaaaatattcatgttaatctccgaaacaaaatacttctatacaaaggaacttcaaattagacattag	104	Q
		\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\| \| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|
T	35402488	tgaagaacaagattgaataaggaaatatgagatgcaaatattcatgtcaatctcctgaatagaattcttctatacaaaggaacttcaaattagagattag	35402389	T

Q	105	attgcatatcaaaagaacttcagaacgactaaatcaataagttggcaattggtgttcaacattgatt	171	Q
		\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	35402388	attgcatataaaaagaacttcagaacgactaaaccaataagttggcaattggtgttcaacattgatt	35402322	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 29; E-Value: 0.0000003

Query Start/End: Original strand, 151 - 211

Target Start/End: Complemental strand, 19411984 - 19411924

Alignment:

Q	151	aattggtgttcaacattgattgtcatcttagaagtcaaaattaacctttttgtagaaagga	211	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \| \|\|\|\|\|\|\| \|\| \|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|
T	19411984	aattggtgttcaacattgattctcatctcaaaagtcaagatcaagctttttgatgaaagga	19411924	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]