View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_high_63 (Length: 212)
Name: NF14684_high_63
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_high_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 41657491 - 41657690
Alignment:
| Q |
1 |
attttgggttctcattacgccaact---ttgtatgttatcgtcattctattattgttttaattgtaacaaacaaataatcaagatgactcctgcatatta |
97 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41657491 |
attttgggttctcattacgccaactaatttgtatgttaccgtcattctattattgttttaattgtaacaaacacataatcaagatgactcctgcatatta |
41657590 |
T |
 |
| Q |
98 |
tatttttctttccatccttttatggatctgttatatcattccttactttttggtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41657591 |
tatttttctttccatccttttatggatctgtgatatcattcctta-tttttggtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggt |
41657689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 110 - 198
Target Start/End: Complemental strand, 43226508 - 43226423
Alignment:
| Q |
110 |
catccttttatggatctgttatatcattccttactttttggtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggtg |
198 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43226508 |
catccttttatggatccatgatatcattccttatttt---gtatagggaactgttgttcttgtttttcaaccagcagaagaaggaggtg |
43226423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 112 - 198
Target Start/End: Complemental strand, 43204800 - 43204715
Alignment:
| Q |
112 |
tccttttatggatctgttatatcattccttactttttggtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggtg |
198 |
Q |
| |
|
||||| |||| |||||| ||||||||||||| ||||| ||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
43204800 |
tccttctatgtatctgtgatatcattcctta-tttttattatagggaacaatagttcttgtttttcaaccagcagaagaaggaggtg |
43204715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 41651630 - 41651678
Alignment:
| Q |
150 |
gtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggtg |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41651630 |
gtatagggaactgttgttcttgtttttcaaccagcagaagaaggaggtg |
41651678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 43211782 - 43211738
Alignment:
| Q |
154 |
agggaacagttgttcttgtttttcaaccagcagaagaaggaggtg |
198 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43211782 |
agggaacgattgttcttgtttttcaaccagcagaagaaggaggtg |
43211738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 110 - 197
Target Start/End: Complemental strand, 25928787 - 25928703
Alignment:
| Q |
110 |
catccttttatggatctgttatatcattccttactttttggtatagggaacagttgttcttgtttttcaaccagcagaagaaggaggt |
197 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| ||| |||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25928787 |
catccttttatggatccatgatatcattccttatttt---gtacagggaaatgttgttcttgtttttcaaccagccgaagaaggaggt |
25928703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University