View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14684_high_68 (Length: 202)

Name: NF14684_high_68
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14684_high_68
NF14684_high_68
[»] chr5 (1 HSPs)
chr5 (14-184)||(7546148-7546318)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 14 - 184
Target Start/End: Complemental strand, 7546318 - 7546148
Alignment:
14 agcataggcttttggagggcatcgttgctaagtaaagaagaaatgataaacgtttagattagcttcaatnnnnnnngtgagatttttctccattttttaa 113  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||       ||||||||||||||||||||||||    
7546318 agcataggcttttggagggcatcgttgctaagcaaagaagaaatgataaacgtttagattagctgcaataaaaaaagtgagatttttctccattttttaa 7546219  T
114 gaaatgaaggcttttattaatacaatttttagtgtatgaaagattaataaacattgctattatggtattaa 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
7546218 gaaatgaaggcttttattaatacaatttttagtgtatgaaagattaacaaacattgctattatggtattaa 7546148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University