View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_27 (Length: 372)
Name: NF14684_low_27
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 53 - 363
Target Start/End: Original strand, 35807191 - 35807507
Alignment:
| Q |
53 |
atcattttatacattttggtaatctagaaggcttcaccnnnnnnn-tagaagatatttttacaaataatttgac-----cgtgtgtggattacttgaaag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35807191 |
atcattttatacattttggtaatctagaaggcttcaccaaaaaaaatagaagatatttttacaaataatttaaccgatacgtgtgtggattacttgaaag |
35807290 |
T |
|
| Q |
147 |
gaaagaaattaccacttttttcggtaaaaggagacgtcgctatctaatttgttcgataaagtaaggttattaatatttttgtggttgaaagctaaaaatt |
246 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35807291 |
gaaagaaattgccacttttttcgataaaaggagacgtcgctacctaatttgttcgataaagtaaagttattaacatttttatggttgaaagctaaaaatt |
35807390 |
T |
|
| Q |
247 |
ctaatgtagtttttgatatttctctatggtagcttaatcatattatgagtttaaattttgctacttagcttgttagcttttttgatgccttggtcttgta |
346 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35807391 |
ctaatttagtttttgatctttctctatggcagcttaatcatattatgtgtttaaattttgctacttagcttgttagcttttttgatgctttggtcttgta |
35807490 |
T |
|
| Q |
347 |
ctagttttgtgcttgac |
363 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35807491 |
ctagttttgtgcttgac |
35807507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University