View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14684_low_39 (Length: 322)
Name: NF14684_low_39
Description: NF14684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14684_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 215 - 317
Target Start/End: Original strand, 53130913 - 53131015
Alignment:
| Q |
215 |
agagagatccttctagggttttctacgagactttacatgaacaaattcccactagtgaaatggcacaaatctggtgagttctcaacggcctattctgcct |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
53130913 |
agagagatccttctagggttttctacgagactttacatgaacaaattcccactagcgaaatggcacaaatctggtgaattctcaacggcctattctgctt |
53131012 |
T |
|
| Q |
315 |
atg |
317 |
Q |
| |
|
||| |
|
|
| T |
53131013 |
atg |
53131015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 88 - 146
Target Start/End: Original strand, 53130786 - 53130844
Alignment:
| Q |
88 |
tttatgatttacctggacaaaaacgtgatccacctgaagaggtttgcataacaatgcac |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53130786 |
tttatgatttacctggacaaaaacgtgatccacctgaagaggtttgcataacaatgcac |
53130844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University